Stem-loop sequence dme-mir-9385

AccessionMI0028934 (change log)
DescriptionDrosophila melanogaster miR-9385 stem-loop
Stem-loop
   ---    u    -    a   u    -  gc au 
5'    acag guau gcaa uga gaau gu  c  a
      |||| |||| |||| ||| |||| ||  |   
3'    uguc caua cguu acu cuua ca  g  u
   ugg    -    u    -   c    u  aa ac 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr4: 400703-400765 [-]
intergenic
Database links

Mature sequence dme-miR-9385-5p

Accession MIMAT0035233
Sequence

1 - 

acaguguaugcaaaugaugaau

 - 22

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9385-3p

Accession MIMAT0035234
Sequence

42 - 

uccucauugcuauaccuguggu

 - 63

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).