Stem-loop sequence sly-MIR9471b

AccessionMI0029104 (change log)
DescriptionSolanum lycopersicum miR9471b stem-loop
Gene family MIPF0002045; MIR9471
Literature search

3 open access papers mention sly-MIR9471b
(3 sentences)

Stem-loop
   gaaaugauuuugugaaaaaaaauuggaucuuugacugauuugggg    g   u   -         u a                        ug   aa    c   auaa    gg ag 
5'                                              uuuu aga uca guugauuuc g ggugcucacucagcuaauaguuau  uuu  gaaa uca    uauu  c  c
                                                |||| ||| ||| ||||||||| | ||||||||||||||||||||||||  |||  |||| |||    ||||  |   
3'                                              gaga ucu agu cagcuaaag c cuacgagugagucgguuaucaaua  agg  cuuu agu    guaa  g  a
   -uuuuguuaaaaaaauuauuuauguagaaaguuagucaguaaaag    g   u   a         u a                        gu   -a    c   ---g    ga ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 1979337-1979576 [-]
intergenic
Clustered miRNAs
< 10kb from sly-MIR9471b
sly-MIR9471bchr12: 1979337-1979576 [-]
sly-MIR9471achr12: 1977726-1977906 [-]
Database links

Mature sequence sly-miR9471b-5p

Accession MIMAT0035441
Sequence

68 - 

gaggugcucacucagcuaaua

 - 88

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR9471b-3p

Accession MIMAT0035442
Sequence

155 - 

uuggcugagugagcaucacug

 - 175

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).