Stem-loop sequence sly-MIR396a

AccessionMI0029111 (change log)
DescriptionSolanum lycopersicum miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

20 open access papers mention sly-MIR396a
(119 sentences)

Stem-loop
   u      u      c              c          u   uauaacaaaaaaaucugauuuuuuuuugauuuuuuuu 
5'  gauucu ugugua uuuuccacagcuuu uugaacugca aca                                     u
    |||||| |||||| |||||||||||||| |||||||||| |||                                     a
3'  cuagga auacau gaagggugucgaaa aacuuggcgu ugu                                     c
   a      u      a              u          -   uaaauuaagaaagguagauuuaaaaaagaaauauuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 2905644-2905807 [-]
intergenic
Database links

Mature sequence sly-miR396a-5p

Accession MIMAT0035455
Sequence

18 - 

uuccacagcuuucuugaacug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR396a-3p

Accession MIMAT0035456
Sequence

129 - 

guucaauaaagcugugggaag

 - 149

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).