Stem-loop sequence sly-MIR9478

AccessionMI0029120 (change log)
DescriptionSolanum lycopersicum miR9478 stem-loop
Stem-loop
   u     aa    u               ag        u         a    uc     c     -gu         uguguaa g     aauga   -     uc 
5'  uauaa  ggga aaggcuuaaauaugu  aucgaacu ugagaaaag cuca  uaugu aucug   aaaguuugg       u guuug     gcc uuuuc  g
    |||||  |||| |||||||||||||||  |||||||| ||||||||| ||||  ||||| |||||   |||||||||       | |||||     ||| |||||   
3'  auauu  ccuu uuccgaguuuauaca  uagcuuga acucuuuuc gagu  auaca uaggc   uuuuaaauu       a uagau     ugg aaaag  a
   a     aa    u               -g        u         c    ua     u     aau         ------g g     ----g   u     ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr11: 52996644-52996848 [+]
intergenic
Database links

Mature sequence sly-miR9478-5p

Accession MIMAT0035473
Sequence

17 - 

gcuuaaauauguagaucgaacu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR9478-3p

Accession MIMAT0035474
Sequence

171 - 

uucgaugacauauuugagccu

 - 191

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).