Stem-loop sequence sly-MIR390b

AccessionMI0029123 (change log)
DescriptionSolanum lycopersicum miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

15 open access papers mention sly-MIR390b
(50 sentences)

Stem-loop
             u    a          g         cau     -acu   uuc 
5' gcauggagaa cugu aagcucagga ggauagcgc   ggaug    caa   g
   |||||||||| |||| |||||||||| |||||||||   |||||    |||    
3' cguacuuuuu ggca uuugaguccu ccuaucgcg   ucuac    guu   a
             c    c          a         auu     acau   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr9: 8388184-8388292 [+]
intergenic
Database links

Mature sequence sly-miR390b-5p

Accession MIMAT0035479
Sequence

17 - 

aagcucaggagggauagcgcc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR390b-3p

Accession MIMAT0035480
Sequence

75 - 

cgcuauccauccugaguuuca

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).