Stem-loop sequence sly-MIR396b

AccessionMI0029124 (change log)
DescriptionSolanum lycopersicum miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

20 open access papers mention sly-MIR396b
(113 sentences)

Stem-loop
   gaugacc      -----ua     gc                  a    cu  -uu   --       g     u    u 
5'        aagucc       gucau  uuuuccacagcuuucuug acuu  uc   gcu  aaauuuu aucuc aaau g
          ||||||       |||||  |||||||||||||||||| ||||  ||   |||  ||||||| ||||| |||| a
3'        uucagg       cggua  aaagggugucgaaagaac ugaa  ag   cga  uuuagag uagag uuua u
   ----uua      uuucgaa     ga                  c    --  uau   ag       -     u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr7: 2628748-2628897 [-]
intergenic
Database links

Mature sequence sly-miR396b

Accession MIMAT0035481
Sequence

25 - 

uuccacagcuuucuugaacuu

 - 45

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).