Stem-loop sequence bdi-MIR9480b

AccessionMI0029128 (change log)
DescriptionBrachypodium distachyon miR9480b stem-loop
Stem-loop
   --              g         a          uu     ca    -  a 
5'   uguuaaggguaugu aggguggua cugaaugugu  gggug  aucc uc c
     |||||||||||||| ||||||||| ||||||||||  |||||  |||| ||  
3'   acaauucccauaca ucccaccau ggcuuacaca  cccac  uggg ag a
   ga              a         g          cu     ug    c  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 22720969-22721075 [-]
intergenic
Database links

Mature sequence bdi-miR9480b

Accession MIMAT0035486
Sequence

10 - 

uaugugagggugguaacugaa

 - 30

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).