Stem-loop sequence bdi-MIR9485

AccessionMI0029134 (change log)
DescriptionBrachypodium distachyon miR9485 stem-loop
Stem-loop
   --     c        c                 a     a                ---------    ug  -  u   -  g  au 
5'   gauca acuuauga guguaggaguugcaaca uuuca cgaccuuuucaaacuu         gaac  cu gg gac ca ga  u
     ||||| |||||||| ||||||||||||||||| ||||| ||||||||||||||||         ||||  || || ||| || ||   
3'   cuagu ugaauauu cacauccucaacguugu aaagu gcuggaagaguuugaa         cuug  ga cu cug gu uu  a
   ac     a        c                 c     g                gguuuuauc    gu  a  u   u  g  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 9203374-9203540 [+]
intergenic
Database links

Mature sequence bdi-miR9485

Accession MIMAT0035492
Sequence

9 - 

uuaugacguguaggaguugca

 - 29

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).