Stem-loop sequence bdi-MIR9496

AccessionMI0029147 (change log)
DescriptionBrachypodium distachyon miR9496 stem-loop
Stem-loop
   -- c    a  c     g  c            ucag     
5'   g cucu ga ugguu gg uuagaugggucc    ccgg 
     | |||| || ||||| || ||||||||||||    ||| c
3'   c gagg cu accga cc aaucuacccagg    ggcc 
   gg c    -  u     a  a            --ua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 1747940-1748017 [-]
intergenic
Database links

Mature sequence bdi-miR9496

Accession MIMAT0035505
Sequence

10 - 

cugguugggcuuagaugggucc

 - 31

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).