Stem-loop sequence dvi-mir-9540

AccessionMI0029279 (change log)
DescriptionDrosophila virilis miR-9540 stem-loop
Stem-loop
   uggug       u               ua  c          ucua 
5'      uuuacau acaugauucguacgu  ca ugaacagauu    c
        ||||||| |||||||||||||||  || ||||||||||    a
3'      aaaugug uguauuaagugugua  gu acuugucuag    u
   ---ua       -               gg  a          uaau 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 6284791-6284883 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9540
dvi-mir-9538scaffold_12855: 6282625-6282718 [+]
dvi-mir-9538bscaffold_12855: 6282879-6282946 [+]
dvi-mir-9700ascaffold_12855: 6284216-6284276 [-]
dvi-mir-9700bscaffold_12855: 6284220-6284277 [+]
dvi-mir-9701ascaffold_12855: 6284350-6284416 [-]
dvi-mir-9701bscaffold_12855: 6284353-6284417 [+]
dvi-mir-9539scaffold_12855: 6284648-6284774 [+]
dvi-mir-9540scaffold_12855: 6284791-6284883 [+]
dvi-mir-9702scaffold_12855: 6286659-6286719 [+]
dvi-mir-9703scaffold_12855: 6286827-6286888 [+]
Database links

Mature sequence dvi-miR-9540-5p

Accession MIMAT0035622
Sequence

20 - 

uucguacguuacacugaacag

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dvi-miR-9540-3p

Accession MIMAT0035623
Sequence

57 - 

ucuguucaaugggaugugug

 - 76

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).