Stem-loop sequence dvi-mir-9542a

AccessionMI0029280 (change log)
DescriptionDrosophila virilis miR-9542 stem-loop
Stem-loop
   ugaca      ag    ccc    a    c           a   uu 
5'      gcguuc  cuug   uggc cuuu uaaucaaagag uga  u
        ||||||  ||||   |||| |||| ||||||||||| |||  u
3'      cgcaag  gggc   aucg gaaa guuaguuucuc auu  u
   cguua      ca    uau    g    u           -   ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9418994-9419089 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9542a
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542bscaffold_12970: 9418038-9418099 [-]
dvi-mir-9542escaffold_12970: 9417366-9417426 [-]
dvi-mir-9542cscaffold_12970: 9416655-9416716 [-]
Database links

Mature sequence dvi-miR-9542a-5p

Accession MIMAT0035624
Sequence

19 - 

ccuggcacuuucuaaucaaaga

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dvi-miR-9542a-3p

Accession MIMAT0035625
Sequence

59 - 

uuugauuguaaagggcuauaucg

 - 81

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).