Stem-loop sequence dvi-mir-9547

AccessionMI0029285 (change log)
DescriptionDrosophila virilis miR-9547 stem-loop
Stem-loop
   ucaag  g g        uu        c   cgca 
5'      ag c agauuucg  ugagugca uuu    u
        || | ||||||||  |||||||| |||    u
3'      uc g ucuagagc  acuuaugu aaa    c
   uuuua  a g        uu        a   uuca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 917881-917955 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9547
dvi-mir-973scaffold_13042: 918343-918437 [-]
dvi-mir-9547scaffold_13042: 917881-917955 [-]
dvi-mir-974-1scaffold_13042: 917735-917829 [-]
dvi-mir-974-2scaffold_13042: 917557-917651 [-]
dvi-mir-9692scaffold_13042: 912386-912483 [-]
Database links

Mature sequence dvi-miR-9547-5p

Accession MIMAT0035634
Sequence

9 - 

cgagauuucguuugagugcacuu

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dvi-miR-9547-3p

Accession MIMAT0035635
Sequence

47 - 

auguauucauucgagaucuggac

 - 69

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).