Stem-loop sequence dvi-mir-974-2

AccessionMI0029291 (change log)
DescriptionDrosophila virilis miR-974-2 stem-loop
Gene family MIPF0002083; mir-974
Stem-loop
   aac      uuc    ug       -        a       c   aa 
5'    ugggca   ccuc  agcgagc agagaagu uuauuug gug  u
      ||||||   ||||  ||||||| |||||||| ||||||| |||  c
3'    acuugu   ggag  ucgcuug uuuuuuca aauaaac uau  u
   --u      uau    ua       g        g       -   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 917557-917651 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-974-2
dvi-mir-973scaffold_13042: 918343-918437 [-]
dvi-mir-9547scaffold_13042: 917881-917955 [-]
dvi-mir-974-1scaffold_13042: 917735-917829 [-]
dvi-mir-974-2scaffold_13042: 917557-917651 [-]
dvi-mir-9692scaffold_13042: 912386-912483 [-]
Database links

Mature sequence dvi-miR-974-2-5p

Accession MIMAT0035645
Sequence

18 - 

gagcgagcagagaaguauuauu

 - 39

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dvi-miR-974-3p

Accession MIMAT0035646
Sequence

60 - 

uaagacuuuuuugguucgcuaug

 - 82

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).