Stem-loop sequence dvi-mir-977

AccessionMI0029293 (change log)
DescriptionDrosophila virilis miR-977 stem-loop
Stem-loop
   ccccu   ccag c    ug    u   c   c     -------    uaua 
5'      ggc    c cagu  cgau gcg gga aucuc       aucg    a
        |||    | ||||  |||| ||| ||| |||||       ||||     
3'      cug    g guca  gcua ugc cuu uagag       uagc    a
   ----g   --ca a    ga    u   a   a     caaccaa    uuac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 906576-906670 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-977
dvi-mir-9692scaffold_13042: 912386-912483 [-]
dvi-mir-9694scaffold_13042: 907106-907161 [+]
dvi-mir-9693scaffold_13042: 907106-907161 [-]
dvi-mir-975scaffold_13042: 906914-907008 [-]
dvi-mir-976scaffold_13042: 906737-906829 [-]
dvi-mir-977scaffold_13042: 906576-906670 [-]
dvi-mir-9695scaffold_13042: 903358-903445 [-]
dvi-mir-9696bscaffold_13042: 903198-903268 [+]
dvi-mir-9696ascaffold_13042: 903188-903280 [-]
dvi-mir-9697scaffold_13042: 903020-903103 [-]
dvi-mir-9698scaffold_13042: 902871-902931 [-]
dvi-mir-9699scaffold_13042: 902700-902761 [-]
Database links

Mature sequence dvi-miR-977-5p

Accession MIMAT0037537
Sequence

20 - 

gcgauugcgcggacaucucauc

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-977-3p

Accession MIMAT0035649
Sequence

63 - 

cgagauauucacguuaucgaga

 - 84

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).