Stem-loop sequence cli-mir-26-1

AccessionMI0029923 (change log)
DescriptionColumba livia miR-26-1 stem-loop
Stem-loop
   cgg      u         c          gua  c 
5'    ccuggu caaguaauc aggauaggcu   uc a
      |||||| ||||||||| ||||||||||   || u
3'    ggauca guucauugg ucuuauccgg   ag c
   gga      c         u          ucg  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375645.1: 399885-399959 [-]
intergenic
Database links

Mature sequence cli-miR-26-5p

Accession MIMAT0038442
Sequence

9 - 

uucaaguaauccaggauaggcu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-26-3p

Accession MIMAT0038443
Sequence

48 - 

ccuauucuugguuacuugcacu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).