Stem-loop sequence cli-mir-99

AccessionMI0029945 (change log)
DescriptionColumba livia miR-99 stem-loop
Stem-loop
      -    -         a         uc   u       ugaa 
5' gau gcca auuggcaua acccguaga  cga cuugugu    a
   ||| |||| ||||||||| |||||||||  ||| |||||||    c
3' cua uggu ugacugugu uggguaucu  gcu gaacacg    g
      g    a         c         uc   c       ucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375804.1: 18429898-18429988 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-99
cli-mir-99KB375804.1: 18429898-18429988 [+]
cli-let-7cKB375804.1: 18430659-18430743 [+]
Database links

Mature sequence cli-miR-99-5p

Accession MIMAT0038478
Sequence

17 - 

aacccguagauccgaucuugug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-99-3p

Accession MIMAT0038479
Sequence

54 - 

caagcucgcuucuaugggucug

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).