Stem-loop sequence cli-mir-101-1

AccessionMI0029947 (change log)
DescriptionColumba livia miR-101-1 stem-loop
Stem-loop
   aca       cuggc                  a    --gu u 
5'    ggcugcc     ucaguuaucacagugcug ugcu    c c
      |||||||     |||||||||||||||||| ||||    |  
3'    ccgacgg     agucaauagugucaugac augg    g u
   cua       uagga                  -    aaau u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 15720695-15720781 [-]
intergenic
Database links

Mature sequence cli-miR-101-5p

Accession MIMAT0038482
Sequence

16 - 

ucaguuaucacagugcugaugcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-101-3p

Accession MIMAT0038483
Sequence

53 - 

uacaguacugugauaacugaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).