Stem-loop sequence cli-mir-129

AccessionMI0029961 (change log)
DescriptionColumba livia miR-129 stem-loop
Literature search

1 open access papers mention cli-mir-129
(1 sentences)

Stem-loop
   u u      -     -       c   cu     -------      uc 
5'  g cccucu cgggu cuuuuug ggu  gggcu       ugcugu  c
    | |||||| ||||| ||||||| |||  |||||       ||||||  u
3'  c gggggg gucua gaaaaac cca  cccga       acgacg  c
   a u      c     u       c   uu     aggacuc      cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375435.1: 1771989-1772080 [-]
intergenic
Database links

Mature sequence cli-miR-129-5p

Accession MIMAT0038503
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-129-3p

Accession MIMAT0038504
Sequence

58 - 

aagcccuuaccccaaaaagua

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).