Stem-loop sequence cli-mir-135-1

AccessionMI0029968 (change log)
DescriptionColumba livia miR-135-1 stem-loop
Stem-loop
   ugc   c            uu            uuauac 
5'    ugu uuguauggcuuu  auuccuauguga      a
      ||| ||||||||||||  ||||||||||||       
3'    aca aacgugccgaag  uagggauauacu      u
   guc   u            -u            ucaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375633.1: 781840-781918 [-]
intergenic
Database links

Mature sequence cli-miR-135-5p

Accession MIMAT0038514
Sequence

11 - 

uauggcuuuuuauuccuauguga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-135-3p

Accession MIMAT0038515
Sequence

50 - 

auauagggauugaagccgugca

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).