Stem-loop sequence cli-mir-137b

AccessionMI0029972 (change log)
DescriptionColumba livia miR-137b stem-loop
Stem-loop
   ccc  -          a   g             g      -  g 
5'    gc ucccuucggc acg guauucucgggcg auaaua cg a
      || |||||||||| ||| ||||||||||||| |||||| ||  
3'    cg aggggagccg ugc cauaagaguucgu uauugu gc c
   --c  c          a   g             -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB377647.1: 3939-4025 [-]
intergenic
Database links

Mature sequence cli-miR-137b-5p

Accession MIMAT0038520
Sequence

17 - 

acggguauucucgggcggauaau

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-137b-3p

Accession MIMAT0038521
Sequence

52 - 

uuauugcuugagaauacgcguag

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).