Stem-loop sequence cli-mir-148b

AccessionMI0029985 (change log)
DescriptionColumba livia miR-148b stem-loop
Stem-loop
     g        g         ccua    cc      agc 
5' gc cccggggc agguucugu    cacu  ggcugu   u
   || |||||||| |||||||||    ||||  ||||||    
3' cg gggcccug uucaagaca    guga  cugaca   a
     a        g         cuac    --      gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376284.1: 322350-322429 [+]
intergenic
Database links

Mature sequence cli-miR-148b-3p

Accession MIMAT0038544
Sequence

50 - 

ucagugcaucacagaacuuggu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).