Stem-loop sequence cli-mir-181a-2

AccessionMI0029990 (change log)
DescriptionColumba livia miR-181a-2 stem-loop
Stem-loop
   auc    -     -      u a   u      cu       a    gaga 
5'    uuug gauag cuucag g aca ucaacg  gucggug guuu    a
      |||| ||||| |||||| | ||| ||||||  ||||||| ||||    c
3'    aaac cuauu ggaguu c ugu aguugc  cagcuac caaa    u
   ccc    a     u      c a   c      --       -    aaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375970.1: 919211-919310 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-181a-2
cli-mir-181a-2KB375970.1: 919211-919310 [-]
cli-mir-181b-2KB375970.1: 918296-918383 [-]
Database links

Mature sequence cli-miR-181a-5p

Accession MIMAT0038550
Sequence

21 - 

aacauucaacgcugucggugaguu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-181a-2-3p

Accession MIMAT0038552
Sequence

59 - 

accaucgaccguugacuguacc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).