Stem-loop sequence cli-mir-193

AccessionMI0029998 (change log)
DescriptionColumba livia miR-193 stem-loop
Stem-loop
   -gguu      u    gu    g    g  a  -----   u 
5'      ccagag cggg  uuug gggc ag ug     agc u
        |||||| ||||  |||| |||| || ||     |||  
3'      gguuuu gccc  aaac cccg uc ac     uug a
   cuggu      c    ug    a    g  a  cuauu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375532.1: 987719-987798 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-193
cli-mir-193KB375532.1: 987719-987798 [+]
cli-mir-365-1KB375532.1: 992939-993027 [+]
Database links

Mature sequence cli-miR-193-5p

Accession MIMAT0038566
Sequence

12 - 

cgggguuuugggggcgagauga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-193-3p

Accession MIMAT0038567
Sequence

49 - 

aacuggcccacaaagucccgcu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).