Stem-loop sequence cli-mir-199-2

AccessionMI0030004 (change log)
DescriptionColumba livia miR-199-2 stem-loop
Stem-loop
   -cucc     c       u        c   u   gacu 
5'      gucug ccagugu cagacuac ugu cag    a
        ||||| ||||||| |||||||| ||| |||     
3'      cggau gguuaca gucugaug aca guu    c
   cgugu     u       c        -   u   agag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376124.1: 50403-50480 [+]
intergenic
Database links

Mature sequence cli-miR-199-5p

Accession MIMAT0038573
Sequence

10 - 

cccaguguucagacuaccuguuc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-199-3p

Accession MIMAT0038574
Sequence

48 - 

uacaguagucugcacauugguua

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).