Stem-loop sequence cli-mir-200a

AccessionMI0030005 (change log)
DescriptionColumba livia miR-200a stem-loop
Stem-loop
   cca    - -    g        -             c    uuuuuu 
5'    uggu c cucu ugggcauc uuacuagacagug ugga      g
      |||| | |||| |||||||| ||||||||||||| ||||       
3'    acca g ggga auuuguag aauggucugucac aucu      g
   caa    a u    a        c             a    caucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376210.1: 2379399-2379493 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-200a
cli-mir-200bKB376210.1: 2377070-2377159 [+]
cli-mir-200aKB376210.1: 2379399-2379493 [+]
cli-mir-429KB376210.1: 2382074-2382167 [+]
Database links

Mature sequence cli-miR-200a-5p

Accession MIMAT0038575
Sequence

18 - 

caucuuacuagacagugcugga

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-200a-3p

Accession MIMAT0038576
Sequence

56 - 

uaacacugucugguaacgauguu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).