Stem-loop sequence cli-mir-204-1

AccessionMI0030008 (change log)
DescriptionColumba livia miR-204-1 stem-loop
Stem-loop
   u  -  -    ccg     u          a     u    gagaau 
5'  ca ug ugac   uggac ucccuuuguc uccua gccu      a
    || || ||||   ||||| |||||||||| ||||| ||||      u
3'  gu ac acug   acuug agggaaacgg agggu cggg      a
   g  c  u    uca     c          a     -    ggaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375428.1: 920641-920734 [+]
intergenic
Database links

Mature sequence cli-miR-204-5p

Accession MIMAT0038580
Sequence

18 - 

uucccuuugucauccuaugccu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-204-3p

Accession MIMAT0038581
Sequence

57 - 

gcugggaaggcaaagggacgu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).