Stem-loop sequence cli-mir-221

AccessionMI0030022 (change log)
DescriptionColumba livia miR-221 stem-loop
Stem-loop
   ugg  cau     ug   u         auuu    -   u 
5'    gg   gaacc  gca acaauguag    cugu guu g
      ||   |||||  ||| |||||||||    |||| ||| u
3'    cc   uuugg  cgu uguuacauc    gaca cga u
   cga  ---     gu   c         ----    a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375371.1: 1295710-1295786 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-221
cli-mir-222aKB375371.1: 1295182-1295275 [+]
cli-mir-221KB375371.1: 1295710-1295786 [+]
Database links

Mature sequence cli-miR-221-5p

Accession MIMAT0038604
Sequence

11 - 

accuggcauacaauguagauuu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-221-3p

Accession MIMAT0038605
Sequence

51 - 

agcuacauugucugcuggguuu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).