Stem-loop sequence cli-mir-222a

AccessionMI0030023 (change log)
DescriptionColumba livia miR-222a stem-loop
Stem-loop
   -u u     c      auc             -     auc   ucuu 
5'   g aguug ucauca   gcucaguagucag uguag   cug    u
     | ||||| ||||||   ||||||||||||| |||||   |||     
3'   c ucaac aguagu   ugggucaucgguc acauc   gac    a
   ug -     -      cuc             u     gac   uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375371.1: 1295182-1295275 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-222a
cli-mir-222aKB375371.1: 1295182-1295275 [+]
cli-mir-221KB375371.1: 1295710-1295786 [+]
Database links

Mature sequence cli-miR-222a-5p

Accession MIMAT0038606
Sequence

18 - 

cgcucaguagucaguguagaucc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-222a-3p

Accession MIMAT0038607
Sequence

57 - 

agcuacaucuggcuacugggucuc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).