Stem-loop sequence cli-mir-222b

AccessionMI0030024 (change log)
DescriptionColumba livia miR-222b stem-loop
Stem-loop
   -caa    -      -  cu             -     gau    cu a ag 
5'     uggu gcucuu gg  gcucaguagucgg uguag   cugu  g c  u
       |||| |||||| ||  ||||||||||||| |||||   ||||  | |   
3'     acca ugggaa cc  ugggucauuaguc acauc   gaca  c g  c
   ucac    g      a  ac             u     ---    au - cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375349.1: 1257557-1257656 [+]
intergenic
Database links

Mature sequence cli-miR-222b-3p

Accession MIMAT0038608
Sequence

60 - 

agcuacaucugauuacugggucac

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).