Stem-loop sequence cli-mir-338b

AccessionMI0030033 (change log)
DescriptionColumba livia miR-338b stem-loop
Stem-loop
   -acu  --   u      g  -      u   -         agu    ug a 
5'     gc  ugc ccuccu cc caacaa auc cuggugcug   gagu  c g
       ||  ||| |||||| || |||||| ||| |||||||||   ||||  | a
3'     cg  acg ggggga gg guuguu uag gacuacgac   cuca  g c
   cuac  uc   u      -  a      u   u         ---    ga a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375601.1: 79313-79412 [+]
intergenic
Database links

Mature sequence cli-miR-338b-5p

Accession MIMAT0038620
Sequence

20 - 

aacaauauccuggugcugagug

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-338b-3p

Accession MIMAT0038621
Sequence

58 - 

uccagcaucagugauuuuguuga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).