Stem-loop sequence cli-mir-451

AccessionMI0030046 (change log)
DescriptionColumba livia miR-451 stem-loop
Stem-loop
   ---    g   g a                 u 
5'    gccg cgg g aaccguuaccauuacug g
      |||| ||| | |||||||||||||||||  
3'    cggc gcc u uugguaaugguaaugau u
   ggu    a   g c                 u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375376.1: 3184903-3184965 [-]
intergenic
Database links

Mature sequence cli-miR-451-5p

Accession MIMAT0038643
Sequence

11 - 

aaaccguuaccauuacuguguuu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).