Stem-loop sequence cli-mir-599

AccessionMI0030059 (change log)
DescriptionColumba livia miR-599 stem-loop
Stem-loop
   aca   u        a        gg     -  uu 
5'    gug guuugaua gcugacau  gacag ga  u
      ||| |||||||| ||||||||  ||||| ||  c
3'    uac caaacuau ugacugug  uuguc cu  u
   cca   u        a        --     a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375314.1: 1574678-1574749 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-599
cli-mir-875KB375314.1: 1574513-1574589 [+]
cli-mir-599KB375314.1: 1574678-1574749 [+]
Database links

Mature sequence cli-miR-599-3p

Accession MIMAT0038666
Sequence

47 - 

uugugucaguauaucaaacuca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).