Stem-loop sequence cli-mir-1416

AccessionMI0030065 (change log)
DescriptionColumba livia miR-1416 stem-loop
Stem-loop
   gguu   u    uuc            cgc    ccuuuu 
5'     gac cucu   cuuaacucaugc   ugug      u
       ||| ||||   ||||||||||||   ||||      a
3'     cug gaga   gaguugagugug   acac      u
   ----   u    cau            uua    uuuguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375428.1: 1182287-1182365 [-]
intergenic
Database links

Mature sequence cli-miR-1416-5p

Accession MIMAT0038676
Sequence

14 - 

uccuuaacucaugccgcugugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1416-3p

Accession MIMAT0038677
Sequence

51 - 

acaauugugugaguugaguaca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).