Stem-loop sequence cli-mir-1552

AccessionMI0030069 (change log)
DescriptionColumba livia miR-1552 stem-loop
Stem-loop
   ---cuu       c     a         c    a     g    ga u 
5'       gucuaca gggga guuagugcg ggua gcuag gugu  g u
         ||||||| ||||| ||||||||| |||| ||||| ||||  |  
3'       uaggugu ccccu caaucacgu ucgu cgauc cacg  c u
   gagucg       c     -         c    -     g    -a g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375445.1: 1494054-1494147 [-]
intergenic
Database links

Mature sequence cli-miR-1552-5p

Accession MIMAT0038683
Sequence

19 - 

uuagugcgcgguaagcuagggug

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1552-3p

Accession MIMAT0038684
Sequence

55 - 

cgcuagcugcucugcacuaacu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).