Stem-loop sequence cli-mir-1803-2

AccessionMI0030083 (change log)
DescriptionColumba livia miR-1803-2 stem-loop
Stem-loop
   aug  uu     ----u    gc    g       ccu   c  aaag 
5'    cu  uagca     cuga  caaa cccacug   uua ug    c
      ||  |||||     ||||  |||| |||||||   ||| ||     
3'    ga  gucgu     gacu  guuu gggugac   agu ac    c
   --g  uu     uucgc    -a    g       uuc   u  cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375483.1: 325771-325861 [-]
intergenic
Database links

Mature sequence cli-miR-1803-3p

Accession MIMAT0038704
Sequence

52 - 

auugacuucagugggguuuga

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).