Stem-loop sequence cli-mir-9615

AccessionMI0030092 (change log)
DescriptionColumba livia miR-9615 stem-loop
Stem-loop
     u     a   u      c   u      a   c  uuucg 
5' ag uggug cca uuuucu cca ggcugu uaa cc     a
   || ||||| ||| |||||| ||| |||||| ||| ||     u
3' uc accac ggu gaagga ggu ucgaca guu gg     a
     u     c   c      u   u      c   a  uuccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375449.1: 1290965-1291051 [-]
intergenic
Database links

Mature sequence cli-miR-9615-5p

Accession MIMAT0038719
Sequence

17 - 

ucucccauggcuguauaaccc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9615-3p

Accession MIMAT0038720
Sequence

54 - 

uugcacagcuuugguaggaag

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).