Stem-loop sequence cli-mir-9624

AccessionMI0030103 (change log)
DescriptionColumba livia miR-9624 stem-loop
Stem-loop
   gau     -  g     u    c u     cu   g g   a 
5'    gggcu ca uugug ccug c uggcu  gcu u agg a
      ||||| || ||||| |||| | |||||  ||| | ||| c
3'    cccga gu gacac ggac g accgg  cga g ucu u
   uuc     c  -     -    u u     -c   - g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375945.1: 142043-142124 [+]
intergenic
Database links

Mature sequence cli-miR-9624-5p

Accession MIMAT0038739
Sequence

11 - 

guuguguccugccuuggcucug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9624-3p

Accession MIMAT0038740
Sequence

54 - 

cggccaugucaggcacagugc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).