Stem-loop sequence cli-mir-9643

AccessionMI0030123 (change log)
DescriptionColumba livia miR-9643 stem-loop
Stem-loop
   cug        a  c    c  c        au c     uac 
5'    ugguaccg cc ugcg gg cgguacug  c ugcag   c
      |||||||| || |||| || ||||||||  | |||||    
3'    accauggu gg acgu cc gucauggc  g guguc   a
   cua        c  u    c  a        cg c     cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375451.1: 66187-66274 [+]
intergenic
Database links

Mature sequence cli-miR-9643-5p

Accession MIMAT0038779
Sequence

18 - 

cgcggccgguacugauccugca

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9643-3p

Accession MIMAT0038780
Sequence

52 - 

ugcggccgguacugacccugca

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).