Stem-loop sequence cli-mir-9647

AccessionMI0030127 (change log)
DescriptionColumba livia miR-9647 stem-loop
Stem-loop
   agg  a    --u  uu  c         u        gu   ccc 
5'    ug gggc   gg  cc gcgcuggug guggcucc  ggc   g
      || ||||   ||  || ||||||||| ||||||||  |||    
3'    ac ccug   cu  gg cgcgaccac cgccgagg  ccg   a
   ugg  c    ucu  gu  u         u        gc   ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375841.1: 292030-292121 [+]
intergenic
Database links

Mature sequence cli-miR-9647-5p

Accession MIMAT0038787
Sequence

15 - 

ucccgcgcugguguguggcucc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9647-3p

Accession MIMAT0038788
Sequence

57 - 

agccgcucaccagcgcuggugu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).