Stem-loop sequence cli-mir-9648

AccessionMI0030128 (change log)
DescriptionColumba livia miR-9648 stem-loop
Stem-loop
   -a a      cuca           u   -     ucaau 
5'   g ggccau    ugccauuaauu cua agcag     g
     | ||||||    ||||||||||| ||| |||||     a
3'   c ccggua    acgguaauuaa gau ucguc     g
   ca -      uaaa           -   g     uuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375520.1: 298713-298791 [-]
intergenic
Database links

Mature sequence cli-miR-9648-5p

Accession MIMAT0038789
Sequence

12 - 

caugccauuaauuucuaagca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9648-3p

Accession MIMAT0038790
Sequence

50 - 

cuguagaauuaauggcaaaau

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).