Stem-loop sequence cli-mir-1756a

AccessionMI0030342 (change log)
DescriptionColumba livia miR-1756a stem-loop
Stem-loop
   --aucuu  gc    a  u          a     gca    uccaccga 
5'        gg  caga uc cagcuggugu aguca   gagc        c
          ||  |||| || |||||||||| |||||   ||||         
3'        uc  gucu gg gucgaccaca uuagu   cucg        a
   ucugucu  uu    a  u          c     gac    ugauuauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375985.1: 168259-168358 [-]
intergenic
Database links

Mature sequence cli-miR-1756a-3p

Accession MIMAT0039100
Sequence

61 - 

uccagugauucacaccagcugu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).