Stem-loop sequence dsi-mir-2498a

AccessionMI0030848 (change log)
DescriptionDrosophila simulans miR-2498a stem-loop
Stem-loop
   --ua       u       cuuu       u 
5'     aaaaguc guuaugc    uuuugug g
       ||||||| |||||||    ||||||| u
3'     uuuucag caauaug    aaaacau u
   uuca       c       --cc       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15133881-15133941 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-2498a
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-2498a-5p

Accession MIMAT0039101
Sequence

1 - 

uaaaaagucuguuaugccuuuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-2498a-3p

Accession MIMAT0039102
Sequence

39 - 

aaccguauaaccgacuuuuacu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).