Stem-loop sequence dya-mir-2498

AccessionMI0030895 (change log)
DescriptionDrosophila yakuba miR-2498 stem-loop
Stem-loop
   --     -       u   c   uu      -  ga 
5'   aauau uuaaguc guu ugc  agauuu gu  a
     ||||| ||||||| ||| |||  |||||| ||  u
3'   uuaug aauucgg cga acg  ucuaaa ca  u
   uu     u       c   c   --      a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 12723909-12723977 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-2498
dya-mir-992chr2R: 12723683-12723748 [+]
dya-mir-991chr2R: 12723801-12723862 [+]
dya-mir-2498chr2R: 12723909-12723977 [+]
dya-mir-9681chr2R: 12724136-12724190 [+]
dya-mir-311bchr2R: 12724551-12724629 [+]
dya-mir-312chr2R: 12724700-12724766 [+]
dya-mir-311achr2R: 12724827-12724906 [+]
dya-mir-310chr2R: 12724935-12725022 [+]
Database links

Mature sequence dya-miR-2498-5p

Accession MIMAT0039166
Sequence

6 - 

uuaagucuguucugcuuagauu

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dya-miR-2498-3p

Accession MIMAT0039167
Sequence

42 - 

aaucugcacagccggcuuaau

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).