Stem-loop sequence dvi-mir-9696b

AccessionMI0030938 (change log)
DescriptionDrosophila virilis miR-9696b stem-loop
Stem-loop
   --a           ca         -------cua   c 
5'    aaaggcccuuu  gacuguuau          uga u
      |||||||||||  |||||||||          |||  
3'    uuuccgggaaa  cugacgaua          acu a
   cgc           ag         cacguaaaaa   g 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 903198-903268 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9696b
dvi-mir-9699scaffold_13042: 902700-902761 [-]
dvi-mir-9698scaffold_13042: 902871-902931 [-]
dvi-mir-9697scaffold_13042: 903020-903103 [-]
dvi-mir-9696ascaffold_13042: 903188-903280 [-]
dvi-mir-9696bscaffold_13042: 903198-903268 [+]
dvi-mir-9695scaffold_13042: 903358-903445 [-]
dvi-mir-977scaffold_13042: 906576-906670 [-]
dvi-mir-976scaffold_13042: 906737-906829 [-]
dvi-mir-975scaffold_13042: 906914-907008 [-]
dvi-mir-9694scaffold_13042: 907106-907161 [+]
dvi-mir-9693scaffold_13042: 907106-907161 [-]
dvi-mir-9692scaffold_13042: 912386-912483 [-]
Database links

Mature sequence dvi-miR-9696b-5p

Accession MIMAT0039234
Sequence

2 - 

aaaggcccuuucagacuguuau

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9696b-3p

Accession MIMAT0039235
Sequence

49 - 

agcagucgaaaagggccuuucg

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).