Stem-loop sequence dvi-mir-9697

AccessionMI0030939 (change log)
DescriptionDrosophila virilis miR-9697 stem-loop
Stem-loop
   --a  c  uc    a           -----u g    -uac  g 
5'    gc gu  cuga gugucaaauag      a guac    uc u
      || ||  |||| |||||||||||      | ||||    ||  
3'    cg ca  gacu cacgguuuauu      u caug    ag a
   gua  a  gu    a           uuuagu g    uaaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 903020-903103 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9697
dvi-mir-9692scaffold_13042: 912386-912483 [-]
dvi-mir-9694scaffold_13042: 907106-907161 [+]
dvi-mir-9693scaffold_13042: 907106-907161 [-]
dvi-mir-975scaffold_13042: 906914-907008 [-]
dvi-mir-976scaffold_13042: 906737-906829 [-]
dvi-mir-977scaffold_13042: 906576-906670 [-]
dvi-mir-9695scaffold_13042: 903358-903445 [-]
dvi-mir-9696bscaffold_13042: 903198-903268 [+]
dvi-mir-9696ascaffold_13042: 903188-903280 [-]
dvi-mir-9697scaffold_13042: 903020-903103 [-]
dvi-mir-9698scaffold_13042: 902871-902931 [-]
dvi-mir-9699scaffold_13042: 902700-902761 [-]
Database links

Mature sequence dvi-miR-9697-5p

Accession MIMAT0039236
Sequence

1 - 

agccguuccugaagugucaaau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9697-3p

Accession MIMAT0039237
Sequence

59 - 

uuauuuggcacaucagugacag

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).