Stem-loop sequence dvi-mir-9699

AccessionMI0030941 (change log)
DescriptionDrosophila virilis miR-9699 stem-loop
Stem-loop
   --g     u   c uu     a    cu uu 
5'    uacuc acg u  uggga cgag  c  u
      ||||| ||| |  ||||| ||||  |   
3'    augag ugc g  accuu gcuc  g  g
   gag     u   c uu     g    ac ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 902700-902761 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9699
dvi-mir-9692scaffold_13042: 912386-912483 [-]
dvi-mir-9694scaffold_13042: 907106-907161 [+]
dvi-mir-9693scaffold_13042: 907106-907161 [-]
dvi-mir-975scaffold_13042: 906914-907008 [-]
dvi-mir-976scaffold_13042: 906737-906829 [-]
dvi-mir-977scaffold_13042: 906576-906670 [-]
dvi-mir-9695scaffold_13042: 903358-903445 [-]
dvi-mir-9696bscaffold_13042: 903198-903268 [+]
dvi-mir-9696ascaffold_13042: 903188-903280 [-]
dvi-mir-9697scaffold_13042: 903020-903103 [-]
dvi-mir-9698scaffold_13042: 902871-902931 [-]
dvi-mir-9699scaffold_13042: 902700-902761 [-]
Database links

Mature sequence dvi-miR-9699-5p

Accession MIMAT0039240
Sequence

1 - 

guacucuacgcuuuugggaacg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9699-3p

Accession MIMAT0039241
Sequence

40 - 

gguuccauugccguugaguaga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).