Stem-loop sequence dvi-mir-9702

AccessionMI0030948 (change log)
DescriptionDrosophila virilis miR-9702 stem-loop
Stem-loop
   --       cg     u     c  uc  cc 
5'   ugagcgu  guugg guuug uu  gu  g
     |||||||  ||||| ||||| ||  ||   
3'   auucgca  caacc caaau ag  ca  u
   aa       aa     -     u  uu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12855: 6286659-6286719 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9702
dvi-mir-9538scaffold_12855: 6282625-6282718 [+]
dvi-mir-9538bscaffold_12855: 6282879-6282946 [+]
dvi-mir-9700ascaffold_12855: 6284216-6284276 [-]
dvi-mir-9700bscaffold_12855: 6284220-6284277 [+]
dvi-mir-9701ascaffold_12855: 6284350-6284416 [-]
dvi-mir-9701bscaffold_12855: 6284353-6284417 [+]
dvi-mir-9539scaffold_12855: 6284648-6284774 [+]
dvi-mir-9540scaffold_12855: 6284791-6284883 [+]
dvi-mir-9702scaffold_12855: 6286659-6286719 [+]
dvi-mir-9703scaffold_12855: 6286827-6286888 [+]
Database links

Mature sequence dvi-miR-9702-5p

Accession MIMAT0039254
Sequence

1 - 

ugagcgucgguugguguuug

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9702-3p

Accession MIMAT0039255
Sequence

40 - 

uuaaacccaacaaacgcuuaa

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).