Stem-loop sequence dvi-mir-9708c

AccessionMI0030962 (change log)
DescriptionDrosophila virilis miR-9708c stem-loop
Stem-loop
   ---     a       -        uuu   uu 
5'    ugagc cagcuaa acauauaa   uuu  u
      ||||| ||||||| ||||||||   |||   
3'    acucg gucgauu uguguauu   gaa  u
   agu     g       g        cuu   ca 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13042: 2032606-2032669 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9708c
dvi-mir-9708ascaffold_13042: 2033003-2033121 [-]
dvi-mir-9708bscaffold_13042: 2032720-2032835 [-]
dvi-mir-9708cscaffold_13042: 2032606-2032669 [-]
dvi-mir-9708dscaffold_13042: 2032476-2032534 [-]
dvi-mir-9719scaffold_13042: 2032315-2032396 [-]
Database links

Mature sequence dvi-miR-9708c-5p

Accession MIMAT0039273
Sequence

1 - 

ugagcacagcuaaacauauaau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9708c-3p

Accession MIMAT0039274
Sequence

41 - 

uauguguguuagcugggcucaug

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).