Stem-loop sequence dvi-mir-9544b

AccessionMI0030965 (change log)
DescriptionDrosophila virilis miR-9544b stem-loop
Stem-loop
   ---       c  c       --      gua 
5'    ugcgcgg gg ucuuuua  acgagu   a
      ||||||| || |||||||  ||||||   c
3'    acguguc cc agaaaau  ugcuca   a
   uaa       a  -       au      aaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9429010-9429070 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9544b
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
Database links

Mature sequence dvi-miR-9544b-5p

Accession MIMAT0039279
Sequence

1 - 

ugcgcggcggcucuuuuaacg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dvi-miR-9544b-3p

Accession MIMAT0039280
Sequence

39 - 

uuauaaaagaccacugugcaa

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).