Stem-loop sequence dvi-mir-9541a

AccessionMI0030968 (change log)
DescriptionDrosophila virilis miR-9541a stem-loop
Stem-loop
   -u          a        -   agcauaa 
5'   agcauaguag ucucuuaa ccg       a
     |||||||||| |||||||| |||        
3'   ucgugucauc agaggauu ggc       a
   au          a        u   caaaaga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12970: 9428406-9428469 [+]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-9541a
dvi-mir-9542ascaffold_12970: 9418994-9419089 [-]
dvi-mir-9542dscaffold_12970: 9419392-9419452 [-]
dvi-mir-9721scaffold_12970: 9419681-9419786 [-]
dvi-mir-9713scaffold_12970: 9426638-9426704 [-]
dvi-mir-9714scaffold_12970: 9426640-9426709 [+]
dvi-mir-9712scaffold_12970: 9426825-9426912 [-]
dvi-mir-9720scaffold_12970: 9426838-9426903 [+]
dvi-mir-9711scaffold_12970: 9427098-9427154 [-]
dvi-mir-9543ascaffold_12970: 9427846-9427976 [-]
dvi-mir-9710scaffold_12970: 9428001-9428064 [-]
dvi-mir-9541bscaffold_12970: 9428404-9428468 [-]
dvi-mir-9541ascaffold_12970: 9428406-9428469 [+]
dvi-mir-9709scaffold_12970: 9428722-9428838 [-]
dvi-mir-9544ascaffold_12970: 9428974-9429102 [-]
dvi-mir-9544bscaffold_12970: 9429010-9429070 [+]
dvi-mir-9545scaffold_12970: 9429441-9429543 [-]
dvi-mir-9544cscaffold_12970: 9429631-9429694 [-]
Database links

Mature sequence dvi-miR-9541a-5p

Accession MIMAT0039285
Sequence

1 - 

uagcauaguagaucucuuaacc

 - 22

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence dvi-miR-9541a-3p

Accession MIMAT0039286
Sequence

42 - 

guuuaggagaacuacugugcuu

 - 63

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).